Text Editors 11. IMR90 4hr bystander experiment 0.5Gy alpha particle strip dish format, A TGFB Responsive Gene Expression Signature is Associated With More Severe Skin and Lung Disease in Diffuse Scleroderma, Global gene expression analysis of undifferentiated H1 hESC, and hEB cells differentiated with SF BVF2H conditions, Analysis of wild-type and C mutant human HPIV1 and interferon beta treatment in human respiratory epithelial A549 cells, Gene expression profiling of invasive breast cancer events from the tamoxifen prevention trial, Relapse-related molecular signature in lung adenocarcinomas identifies patients with dismal prognosis, Human ES cells' gene expression difference compared with that of the adult cells including CCD-1079sk and IMR90. This can be a challenge when working with most PCB software companies, but not Altium. Gene expression in an EMT model using an immortalized bronchial epithelial cell line induced by TGF-β1, The downstream molecules of Notch signaling in vascular endothelial cell senescence, Involvement of transcription factor early growth response 4 (EGR4) in lung cancer bone metastasis, Gene expression profiles of 5 cancer cell lines, Gene expression profiling of tumor-adjacent histologically normal lung tissues from lung SCC patients, MGMT modulates glioblastoma angiogenesis and response to the tyrosine kinase inhibitor sunitinib, Comparison of gene expression profilling between iPS vs SSEA-1 positive or SSEA-1/3 negative sorted N417 cell line, ICL010 - Infection of Calu-3 cells with H1N1 influenza virus A/Netherlands/602/2009, Inter-individual variability in gene expression profiles in human hepatocytes and comparison with HepaRG cells, mRNA expression after siRNA-mediated knock down of Enhancer of zeste homolog 2 (Ezh2) in human umbilical vein endothelial cells, Gene expression profiling of colorectal normal mucosa, adenoma and adenocarcinoma tissues, WHIM Gene Expression Data_Update Through WHIM 26, Effects of sample size on differential gene expression, rank order and prediction accuracy of a gene signature, Decidual Endothelial Cells (DEC) and endothelial cells from human skin (ADMEC), Immune and tumor cell gene expression from node positive and node negative breast cancers' primary tumor, lymph nodes and peripheral blood, Characterization of gene expression profiles induced by HIC-1 reactivation on breast cancer, Differential gene expression profile of newly diagnosed versus relapse acute promyelocytic leukemia, Comparison of gene expression profile of naive versus arsenic trioxide resistant acute promyelocytic leukemia cell line NB4, The Cytokines Interleukin-1 and Interferon-gamma Differentially Program Beta-glucan–activated Dendritic Cells via IkappaB-zeta Modulation, An eQTL study in the Japanese population [gene expression_1], An eQTL study in the Japanese population [gene expression_2], An eQTL study in the Japanese population [gene expression_3], Gene expression in human prostate cancer cell lines regulated by HIC1 gene, Identification of single nucleotide polymorphisms regulating peripheral blood mRNA expression with genome-wide significance: an eQTL study in the Japanese population, Cluster analysis reveals differential transcript profiles associated with resistance training-induced human skeletal muscle hypertrophy, Gene expression changes induced by the pan-PIM inhibitor ETP-39010 in 4 peripheral T cell lymphoma cell lines, Quiescent Fibroblasts Exhibit High Metabolic Activity, A microRNA network regulates proliferative timing and extracellular matrix synthesis during cellular quiescence in fibroblasts [mRNA], A microRNA network regulates proliferative timing and extracellular matrix synthesis during cellular quiescence in fibroblasts, EID1 knochdown by small RNA induces the large-scale conversion of adipose-derived mesenchymal stem cells into hematopoietic stem cells, TCR affinity-dependent functional inhibition via PD-1 and SHP-1 phosphatase, An integrative genomic and transcriptomic analysis reveals potential targets associated with cell proliferation in uterine leiomyomas, Novel dedifferentiated liposarcoma xenograft models reveal PTEN down regulation as a malignant signature and response to PI3K pathway inhibition, RIP: miR-202 mimic-transfected HeLa cells vs. negative control, Human lymphoblastoid cell lines: controls vs. patients with autism, Exression profiling of 9-cisRA in adrenocortical carcinoma cell line, Global gene expression analysis of peripheral blood cells, pluripotent cell lines, and iPS-derived T cells, ERβ activation by genistein promotes metastatic progression in prostate cancer, ICL0011 - Host response in human Calu-3 cells to infection with A/Vietnam/1203-CIP048_RG3/2004 (H5N1) (PB1-F2 deletion), A/Vietnam/1203-CIP048_RG3/2004 (H5N1) (PB2-627E mutant) or WT: A/Vietnam/1203/2004 (H5N1), ICL0012 - Host response in human Calu-3 cells to infection with NS1trunc124: A/Vietnam/1203-CIP048_RG4/2004 (H5N1) or WT: A/Vietnam/1203/2004 (H5N1), Phenotypic characterization of retinoic acid differentiated SH-SY5Y cells by transcriptional profiling, Transcriptional interaction network analyses in dorsal nucleus of vagus nerve, locus coeruleus and substantia nigra in Parkinson's disease. vised：序列输入分析和格式转换软件. Gene expression and methylation profile of breast cancer cells. Mit GoToMeeting, einer Software für Online-Meetings, Video- und Webkonferenzen, können Sie in Echtzeit mit Kunden und Kollegen zusammenarbeiten. Molecular responses of human lung epithelial cells to the toxicity of copper oxide nanoparticles inferred from whole genome expression analysis. GSE10469: Time course progression of BMP4-treated hESC gene expressions under 4 % and 20 % oxygen conditions. Von der ersten Zeichnung bis zur fertigen Inneneinrichtung: Mit unserer 3D-CAD-Software planen, präsentieren und verkaufen Sie Ihre Projekte, bestellen das dafür benötigte Material oder erstellen perfekte Werkpläne, die Fehler auf der Baustelle vermeiden. image.canon image.canon image.canon. Sichtungen von Streetview Autos in Deutschland. Printed circuit board design today often requires collaboration to optimize development. Gene expression profiles of Calu-3 lung epithelial cells after neutrophil transmigration. Projektziel ist es, Bodenrichtwerte der Gutachterausschüsse für Grundstückswerte länderübergreifend einheitlich, webbasiert und leicht zugänglich für die breite Öffentlichkeit bereitzustellen. 3D Modeling 5; 3D Rendering 1; Editors 4. Unlock the Power of Altium’s Import and Export Capabilities. Learn about interfacing with other EDA tools. Microsoft® Office online can view and edit files from Document Management as well. Epigenetic Silencing of DKK3 in Medulloblastoma. Virtually all manufacturers accept Gerbers; however, they can be inaccurate and require conversion. Graphics Conversion 4; Presentation 2; Viewers 4. The almost exclusive medium for this transfer is the design file extensions. Für Städte mit engen Straßen brauchten wir ein Fahrzeug, das nicht nur wendig ist, sondern auch den Street View-Trekker problemlos transportieren kann. PenSimv：青霉素发酵模拟软件. 5000mAh Akku I AI-Dreifach-Kamera I 6,3 Zoll HONOR FullView-Display HONOR 8A 2020 3GB+64GB Black 6,09 Zoll Full View Display | 3GB+64GB | 13MP Kamera HONOR 9X Lite 48MP Ultra-Clarity-Kamera *128GB Speicher WEARABLES HONOR MagicWatch 2 46MM Fitness Tracker Armband, Amoled Touchscreen, GPS, Fitness Armbanduhr, Herzfrequenzmessung, 5 ATM was Identification of SOX4 novel transcriptional targets. Ob du solo oder kooperativ mit Freunden spielst, League of Legends ist ein wettkampforientiertes, rasantes Action-Strategiespiel für alle, die sich ihre Siege mit Zähnen und Klauen erkämpfen wollen. 2D-/3D-Programm, 3D-Funktionen basierend auf 3D Acis Modeler und um eigene Funktionen erweitert; funktionale Ähnlichkeit und Kompatibilität zu Autocad: dwg, dxf, dwf, flx: proprietär, 30 Tage Testversion: Linux, Windows, macOS ASi-Profile: ITB Paul Schneider: Stahlbau, Metallbau, Betriebsmittelkonstruktion Including a free PCB file viewer download that allows you to view virtually all design file formats; including BDA files. Expression profiling of human peripheral blood before and after omega 3 dietary supplement. The industry’s leading unified, comprehensive PCB design software with BRD file view and import capabilities. Comprehensive evaluation and validation of your design is simplified with Altium Designer’s 3D viewer. The development of native CAD file formats has transformed the PCB design software industry. Office/Business 6. By importing your BRD or other design file format you can unlock the full power of Altium Designer. By unlocking Altium Designer you can not only view any design format but also import, incorporate and modify your design and export in any format. Learn about Altium’s Multiple Format PCB File Viewer. Get Altium Designer for free for 2 weeks, Learn    |    Get Inspired    |    Connect. Altium Designer is built to allow you to work seamlessly with other EDA tools. Learn about Altium Designer’s 3D viewing capabilities. Here is a list of best free BRD file viewer software for Windows.Using this software, you can view PCB layouts or circuit designs saved in a BRD file. If you find any infringed material indexed by crack.ms you can submit abuse report with explanation and crawled result will be blocked for viewing. Loss of histone demethylase KDM6B enhances aggressiveness of pancreatic cancer through downregulation of C/EBPα, Host Regulatory Network Response to Infection with Highly Pathogenic H5N1 Avian Influenza Virus, mRNA expression profile in PCa And BPH from Chinese patients, Peripheral Blood Mononuclear Cell Gene Expression Profiles May Predict Poor Outcome in Idiopathic Pulmonary Fibrosis. Apache OpenOffice 4.1.3 released 28. Find ich ganz nett. Tool für vereinfachtes 3D-BIM zum Erstellen von 3D-Architekturentwürfen und Dokumentationen. Comparison of human ES cells, mouse ES cells, rat iPS cells and their somatic cells. However, there are many times when you need the capability to view or use non-native files. One of the most popular of these formats is BRD. The proliferation of electronic systems into virtually every aspect of life has spawned many opportunities for designers and developers to creatively ply their trade. We are not able to control every piece of information indexed by crack.ms. View list of unsupported files Viewable Files File extension Authoring … Communications 7. Mit Indeed können Sie Millionen Jobs durchsuchen und somit den nächsten Schritt in Ihrer Karriere planen. Genetic Risk Factors for Type 2 Diabetes: A Trans-Regulatory Genetic Architecture? Document Management supports the upload of many file types between the Plans and Project Files folders. Schematics, PCB layout and 3D visualization provides a interactive CAD experience with no downloads or installations required. compare of mRNA expression between IA and MMA, Caco-2 cells cultured in the presence of Lactobacillus fermentum strains AGR1485 or AGR1487, Global analysis of DNA methylation changes during progression of oral tumorigenesis, mRNA expression profiles of 71 esophageal squamous cell carcinoma cases, Gene expression in male and female smokers, Gene expression profiling of chronic lung disease for the Lung Genomics Research Consortium. Learn how to create your own. The resulting view of the human genome covers 41K unique genes and transcripts which have been verified and optimized by alignment to the human genome assembly and by Agilent's Empirical Validation process. It provides you with a unified design environment with full simultaneous access to your schematic capture, PCB layout and BOM, which gives real-time component data. STEP files (.stp) for 3D and assembly are often used by all major mechanical CAD systems. BRD is a universal bank and offers complete financial services for individuals and companies. Four subgroups by gene expression profile correlate with biological and clinical features in colorectal cancer. 6、序列格式转换. Accession list truncated, click here to browse through all related public accessions, You can also download a list of all accessions here, Agilent-014850 Whole Human Genome Microarray 4x44K G4112F (Probe Name version). SHAE004: SARS-CoV, SARS-dORF6 and SARS-BatSRBD infection of HAE cultures. Identifying functional CpG island methylation markers in clear cell renal cell cancer cell lines, Gene expression of Epstein-Barr Virus (EBV) positive nodal peripheral T cell lymphoma, unspecified (PTCL-U), The NIH Human Pluripotent Stem Cell Database, Cross-Species Comparisons of Transcriptomic Alterations in Human and Rat Primary Hepatocytes Exposed to 2,3,7,8-Tetrachlorodibenzo-p-dioxin: human samples, Cross-Species Comparisons of Transcriptomic Alterations in Human and Rat Primary Hepatocytes Exposed to 2,3,7,8-Tetrachlorodibenzo-p-dioxin, Study of the effect on indoxyl sulfate on endothelial gene expression, Airway smooth muscle reponse to dexamathasone at 4 and 24 hours, Gene and microRNA expression in pulmonary tuberculosis and sarcoidosis, cDNA microarray of hepatocellular carcinoma and nontumor liver tissues, Transcriptome Analysis in Patients with Progressive Coronary Artery Disease, Gene expression profiling of interferon-alpha-treated HTLV-1-infected CD4+ T cell lines, Characterization of T-rapamycin cells by gene expression profiling, Expression profiles in PCa And BPH from Chinese patients, TNF-α treated HUVECs: microRNA negative control VS. miR-181b, Gene expression profiles of monocytes derived from chronic lymphocytic leukemia patients and normal controls. GSE10878: Integrative Genome-wide Analysis of Glioblastoma. April 2014: Apache OpenOffice 4.1.0 released Discovery of Gene Expression Signature in the Overexpression of miR-145 in U87 glioma cell. DIFFERENTIAL GENE EXPRESSION OF MEDULLARY THYROID CARCINOMA REVEALS SPECIFIC MARKERS ASSOCIATED WITH GENETIC CONDITIONS. Altium Designer supports this development with a BRD file viewer free download, as well as other tools. As either of these scenarios will negatively impact your ability to satisfy your customer requirements, it is imperative that your design file(s) include the essential information needed for your board manufacture that reflects your design intent. SHAE003: SARS-CoV, SARS-dORF6 and SARS-BatSRBD infection of HAE cultures. Offer includes current accounts, cards, loans, deposits, investment funds, insurance, service packs, internet banking, SMS banking. Consequently, the PCB design software options have expanded as well. PCB design today often involves many professionals and may require the integration of designs from multiple sources. Using a custom file format is advantageous when working with the originating company’s program. In addition to that, you also get advanced 3D viewer feature in some software that allows you to view PCB layout from all directions and angles. Wählen Sie aus erstklassigen Inhalten zum Thema Car 3d View in höchster Qualität. ... And the 3D viewing capability allows you to inspect and verify all details of your design. SMAD3 targets in A549 lung epithelial cells, Influence of cell cycle on responses of MCF-7 cells to benzo[a]pyrene, Post-epidemic eosinophilia myalgia syndrome associated with L-Tryptophan. Altium Designer is the industries most advanced and comprehensive PCB design software platform. Although, the ability to view BRD designs is a great capability, it is only the tip of the iceberg of Altium Designer. It just works. CDK8 knockdown in HT-29 human colon cancer cells, CDK8 knockdown in HT-29 cells and CDK8 & MED12 knockdown in R1 cells, Integration of BRCA1-mediated miRNA and mRNA signatures reveal miR-146a, miR-99b and miR-205 regulation of the TRAF2 and NFkB pathways (mRNA dataset), Integration of BRCA1-mediated miRNA and mRNA signatures reveal miR-146a, miR-99b and miR-205 regulation of the TRAF2 and NFkB pathways, A Common Peripheral Blood Gene-Set for Diagnosis and Prediction of Operational Tolerance in Pediatric and Adult Liver Transplantation, Genes downstream of p53 mediating its effect on megakaryopoiesis, Chronic hypoxia in patients with colon carcinoma, Mesenchymal Stem Cells Promote the Sustained Expression of CD69 on Activated T-lymphocytes: Roles of Canonical and Non-Canonical NF-κB Signaling, A small molecule modulator of prion protein enhances proliferation and engraftment of mesenchymal stem cells and extends their lifespan upon serial passage in culture, Altered CD45 isoform combination in C77G carriers influences the function of CD4+CD25high FoxP3+ regulatory T cells, Gene expression change in Skov3 after EZH2 knockdown, Gene expression profile of human epidermoid carcinoma KB cells that overexpress thymidine phosphorylase, Transcriptome analysis of endometriotic stromal cells treated with hydrogen peroxide, Pre-miR-375_A549 vs. Pre-miR-NC#2 (Ambion) _A549, Human breast cancer cell lines: vehicle vs. BMP4 incubation, Human breast cancer cell lines: vehicle vs. BMP7 incubation. ForCon：多序列文件格式转换软件. Abonnieren /Jahr (Inkl. Free DWG Viewer 16.0 Final Englisch: Mit dem kostenlosen "Free DWG Viewer" können Sie AutoCAD-Dateien im DWG-, DWF- und DXF-Format öffnen und ansehen. Nass applizierbar auf flache Untergründe. Kostenlose Testversion. Digital oder im Siebdruck bedruckt, lassen sich feinste Ornamente und filigrane Details auf transparenten Untergründen realisieren, wo Plottfolien an ihre Grenzen stoßen. 2D-/3D-Programm, 3D-Funktionen basierend auf 3D Acis Modeler und um eigene Funktionen erweitert; funktionale Ähnlichkeit und Kompatibilität zu Autocad: dwg, dxf, dwf, flx: proprietär, 30 Tage Testversion: Linux, Windows, macOS ASi-Profile: ITB Paul Schneider: Stahlbau, Metallbau, Betriebsmittelkonstruktion SARS-CoV, SARS-dORF6 and SARS-BatSRBD infection of HAE cultures. crack.ms indexes 3d party sites and provides search results in automated mode. Nahtlose Übertragung der Aufnahmen von deiner Canon Kamera auf deine Geräte oder Webdienste. BruteForce3Char ym1 ym2 ym3 ym4 ym5 ym6 ym7 ym8 ym9 yma ymb ymc ymd yme ymf ymg ymh ymi ymj ymk yml ymm ymn ymo ymp ymq ymr yms ymt ymu … 03.01.2020 17.26 3. IL-27, PXN, CXCR4, GZMA, PRF1 and Foxp3 genes are differentially expressed in CD4+ T cells of HTLV-1-infected individuals. Ensure you have what you need tomorrow with Altium Designer. Hosting is supported by UCL, Bytemark Hosting, and other partners. Damit wir auch die engsten Gassen erreichen können, entschied sich unser Team für den indonesischen Motorroller Selis Robin. Myc-regulated gene expression in human fibroblasts, Integrated genome, transcriptome and translatome profiling of neuroblastoma cells, Gene expression profiling of gastric cancer, Genes regulated by PCK Inhibitors, enzastaurin and Go, in CAL-27 cells, a SCCHN cell line, Gene expression patterns of EBV negative BJAB B-lymphoma lines stably and conditionally expressing EBNA-1, Combinatorial effects of microRNA to suppress the myc oncogenic pathway, Different propensity in hematopoietic differentiation potential among distinct human pluripotent stem cell lines, The ETS transcription factor ESE3 controls prostate epithelial cell differentiation, Transcriptomics in response to cigarette smoking in humans, Nickel Chloride (NiCl2) effect on human T cells from whole blood. Melanoma SK-Mel-103 cell line : control vs. treated with pIC/pIC+PEI, A gene expression signature classifying telomerase and ALT immortalization I, A gene expression signature classifying telomerase and ALT immortalization II, GSK3 activates telomerase by regulating dynamic behaviour of multiple transcription factors converging on the hTERT gene, A gene expression signature classifying telomerase and ALT immortalization, Gene expression changes by 2,4-dinitrochlorobenzene in human bulge-derived keratinocytes, Human Adrenocortical Tumors: normal cortex vs inactive adenoma vs cortisol secreting adenoma vs adrenocortical cancer, Expression profiling of nasopharyngeal carcinoma cell lines, Nasopharyngeal carcinoma cell lines TW01 and HONE1: transcriptomic and genomic analyses, RNA Expression Profiling of Lung Tissue Identifies Mutually Distinct Molecular Signatures in PAH and PH Secondary to IPF, Effects of far-infrared rays on normal prostate epithelial cells (PrEC), Effects of far-infrared rays on prostate cancer cells and normal prostate epithelial cells. Identification of dysregulated genes in 3D culture of BRIP1 knockdown cells. (2020): Das Grundgesetz für die Bundesrepublik Deutschland. These typically have to be augmented by a pick-and-place file, drill file, board outline file, image and a text file with descriptions and special requirements. View virtually any design file format; including BRD files with Altium’s PCB file viewer software. This multi-pack (4X44K) formatted microarray represents a compiled view of the human genome as it is understood today. Deutschland reiht sich damit ein in die Liste von Ländern wie die Vereinigten Staaten, Österreich und Großbritannien, in denen derartige Berichte bereits vorliegen. Expression signature as a biomarker for prenatal diagnosis of trisomy 21, The 5p12 breast cancer susceptibility locus affects MRPS30 expression in estrogen-receptor positive tumors, SCL008: icSARS CoV, icSARS-deltaNSP16 or icSARS ExoNI infections of the 2B4 clonal derivative of Calu-3 cells - Time course, Differential expression of genes in adipose derived stem cells, family with sequence similarity 174, member B, ref|NM_207446|ens|ENST00000557398|ens|ENST00000553393|ens|ENST00000327355, Homo sapiens family with sequence similarity 174, member B (FAM174B), mRNA [NM_207446], GO:0016020(membrane)|GO:0016021(integral to membrane), ATCTCATGGAAAAGCTGGATTCCTCTGCCTTACGCAGAAACACCCGGGCTCCATCTGCCA, adaptor-related protein complex 3, sigma 2 subunit, ref|NM_005829|ref|NM_001199058|ref|NR_023361|ref|NR_037582, Homo sapiens adaptor-related protein complex 3, sigma 2 subunit (AP3S2), transcript variant 1, mRNA [NM_005829], GO:0005794(Golgi apparatus)|GO:0006886(intracellular protein transport)|GO:0008565(protein transporter activity)|GO:0016020(membrane)|GO:0016192(vesicle-mediated transport)|GO:0030117(membrane coat)|GO:0030659(cytoplasmic vesicle membrane)|GO:0031410(cytoplasmic vesicle), TCAAGTATTGGCCTGACATAGAGTCCTTAAGACAAGCAAAGACAAGCAAGGCAAGCACGT, ref|NM_014848|ref|NM_001167580|ens|ENST00000557410|ens|ENST00000330276, Homo sapiens synaptic vesicle glycoprotein 2B (SV2B), transcript variant 1, mRNA [NM_014848], GO:0001669(acrosomal vesicle)|GO:0006836(neurotransmitter transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0022857(transmembrane transporter activity)|GO:0030054(cell junction)|GO:0030672(synaptic vesicle membrane)|GO:0031410(cytoplasmic vesicle)|GO:0045202(synapse), ATGTCGGCTGTGGAGGGTTAAAGGGATGAGGCTTTCCTTTGTTTAGCAAATCTGTTCACA, RNA binding protein with multiple splicing 2, ref|NM_194272|ens|ENST00000300069|gb|AK127873|gb|AK124123, Homo sapiens RNA binding protein with multiple splicing 2 (RBPMS2), mRNA [NM_194272], GO:0000166(nucleotide binding)|GO:0003676(nucleic acid binding), CCCTGTCAGATAAGTTTAATGTTTAGTTTGAGGCATGAAGAAGAAAAGGGTTTCCATTCT, ref|NM_020371|ens|ENST00000306730|gb|AF283508|gb|BC010488, Homo sapiens apoptosis, caspase activation inhibitor (AVEN), mRNA [NM_020371], GO:0005515(protein binding)|GO:0005622(intracellular)|GO:0005624(membrane fraction)|GO:0006915(apoptosis)|GO:0006916(anti-apoptosis)|GO:0012505(endomembrane system)|GO:0016020(membrane), GACCAGCCAGTTTACAAGCATGTCTCAAGCTAGTGTGTTCCATTATGCTCACAGCAGTAA, zinc finger and SCAN domain containing 29, ref|NM_152455|ens|ENST00000396976|ens|ENST00000396972|gb|AF525399, Homo sapiens zinc finger and SCAN domain containing 29 (ZSCAN29), mRNA [NM_152455], GO:0003677(DNA binding)|GO:0003700(sequence-specific DNA binding transcription factor activity)|GO:0005622(intracellular)|GO:0005634(nucleus)|GO:0008270(zinc ion binding)|GO:0016032(viral reproduction)|GO:0046872(metal ion binding), AGAGAAACCCTATGGGTGTCATGACTGTGGTAAGTGCTTCAGTAAAAGCTCTGCCCTTAA, vacuolar protein sorting 39 homolog (S. cerevisiae), ref|NM_015289|ens|ENST00000348544|ens|ENST00000318006|gb|AF280814, Homo sapiens vacuolar protein sorting 39 homolog (S. cerevisiae) (VPS39), mRNA [NM_015289], GO:0005083(small GTPase regulator activity)|GO:0005737(cytoplasm)|GO:0005765(lysosomal membrane)|GO:0005768(endosome)|GO:0015031(protein transport)|GO:0016020(membrane)|GO:0030897(HOPS complex)|GO:0031902(late endosome membrane), TGCATTTGCAAGATACCCCAATGGAGTGGTCGTCCATTACTTCTGTTCCAAAGAGGTAAA, ref|NM_007236|ens|ENST00000392151|ens|ENST00000334660|gb|AK299660, Homo sapiens calcium binding protein P22 (CHP), mRNA [NM_007236], GO:0005509(calcium ion binding)|GO:0005737(cytoplasm)|GO:0005829(cytosol)|GO:0006813(potassium ion transport)|GO:0007264(small GTPase mediated signal transduction)|GO:0015459(potassium channel regulator activity)|GO:0017156(calcium ion-dependent exocytosis)|GO:0045056(transcytosis), TAGAACAGAAAATGAGCATCCGATTTCTTCACTAAAGGAGACCAAACTGTTCCTTGCGGT, ref|NM_170589|ref|NM_144508|ens|ENST00000260369|ens|ENST00000533001, Homo sapiens cancer susceptibility candidate 5 (CASC5), transcript variant 1, mRNA [NM_170589], GO:0000087(M phase of mitotic cell cycle)|GO:0000236(mitotic prometaphase)|GO:0000278(mitotic cell cycle)|GO:0000777(condensed chromosome kinetochore)|GO:0001669(acrosomal vesicle)|GO:0001675(acrosome assembly)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005654(nucleoplasm)|GO:0005694(chromosome)|GO:0005730(nucleolus)|GO:0005829(cytosol)|GO:0006334(nucleosome assembly)|GO:0007059(chromosome segregation)|GO:0008608(attachment of spindle microtubules to kinetochore)|GO:0010923(negative regulation of phosphatase activity)|GO:0034080(CenH3-containing nucleosome assembly at centromere)|GO:0051301(cell division)|GO:0071173(spindle assembly checkpoint), CGGTCTCTAGCAAAGATTCAGGCATTGGATCTGTTGCAGGTAAACTGAACCTAAGTCCTT, ref|NM_015251|ens|ENST00000299575|gb|AB007891|gb|CR749457, Homo sapiens ATM interactor (ATMIN), mRNA [NM_015251], GO:0005622(intracellular)|GO:0005634(nucleus)|GO:0006974(response to DNA damage stimulus)|GO:0008270(zinc ion binding)|GO:0046872(metal ion binding), TGGACCTTCGTCAGCTTTGACACCTCTTTTCTGATTTAAAGACACCAAGGAAAACTACAA, ref|NM_023076|ref|NM_001193388|ref|NM_001193389|ens|ENST00000397464, Homo sapiens unkempt homolog (Drosophila)-like (UNKL), transcript variant 3, mRNA [NM_023076], GO:0003676(nucleic acid binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0008270(zinc ion binding)|GO:0016874(ligase activity)|GO:0046872(metal ion binding), AGCAGAGGGGATCCAACGTCAGAGCTTTTAGAATTACTTTTTTAAGCAGCTGTCTTCTGG, ref|NM_017849|ref|NM_001193304|ens|ENST00000432959|ens|ENST00000258439, Homo sapiens transmembrane protein 127 (TMEM127), transcript variant 1, mRNA [NM_017849], GO:0003674(molecular_function)|GO:0005737(cytoplasm)|GO:0005886(plasma membrane)|GO:0008285(negative regulation of cell proliferation)|GO:0016021(integral to membrane)|GO:0032007(negative regulation of TOR signaling cascade), ACCTTCAGTGTAGATCCAGATGGCCAACCTGTCCTTGTTAAGTTACTTGCTTCTTGGGAA, matrix metallopeptidase 15 (membrane-inserted), ref|NM_002428|ens|ENST00000219271|gb|D85510|gb|BC036495, Homo sapiens matrix metallopeptidase 15 (membrane-inserted) (MMP15), mRNA [NM_002428], GO:0004222(metalloendopeptidase activity)|GO:0005509(calcium ion binding)|GO:0005515(protein binding)|GO:0005887(integral to plasma membrane)|GO:0006464(protein modification process)|GO:0006508(proteolysis)|GO:0008047(enzyme activator activity)|GO:0008152(metabolic process)|GO:0008233(peptidase activity)|GO:0008270(zinc ion binding)|GO:0016020(membrane)|GO:0031012(extracellular matrix)|GO:0032355(response to estradiol stimulus)|GO:0043085(positive regulation of catalytic activity), GACCATTTGTTTCTGTTTCCCCGACTGGGGCAGGGTGTTTAGAATTTTCTAAATGTAGTT, ref|NM_002761|ens|ENST00000312511|gb|Y00443|gb|AY651260, Homo sapiens protamine 1 (PRM1), mRNA [NM_002761], GO:0000786(nucleosome)|GO:0003677(DNA binding)|GO:0005634(nucleus)|GO:0005654(nucleoplasm)|GO:0005694(chromosome)|GO:0006323(DNA packaging)|GO:0006997(nucleus organization)|GO:0007275(multicellular organismal development)|GO:0007283(spermatogenesis)|GO:0007286(spermatid development)|GO:0030154(cell differentiation)|GO:0030261(chromosome condensation), GTAGAAGACACTAATTGCACAAAATAGCACATCCACCAAACTCCTGCCTGAGAATGTTAC, ref|NM_005153|ens|ENST00000219473|ens|ENST00000397953|ens|ENST00000540269, Homo sapiens ubiquitin specific peptidase 10 (USP10), mRNA [NM_005153], GO:0002039(p53 binding)|GO:0004221(ubiquitin thiolesterase activity)|GO:0004843(ubiquitin-specific protease activity)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0005769(early endosome)|GO:0006281(DNA repair)|GO:0006508(proteolysis)|GO:0006511(ubiquitin-dependent protein catabolic process)|GO:0008233(peptidase activity)|GO:0008234(cysteine-type peptidase activity)|GO:0016579(protein deubiquitination)|GO:0030330(DNA damage response, signal transduction by p53 class mediator)|GO:0042980(cystic fibrosis transmembrane conductance regulator binding)|GO:0045111(intermediate filament cytoskeleton), TTGGGGTTCGTGCACAACACAGCTTCTGTTGACTCTAACTTCCAAATCAAAATCATTTGG, ref|NM_001537|ens|ENST00000433866|gb|AK172732|gb|BX537440, Homo sapiens heat shock factor binding protein 1 (HSBP1), mRNA [NM_001537], GO:0000122(negative regulation of transcription from RNA polymerase II promoter)|GO:0003714(transcription corepressor activity)|GO:0005634(nucleus)|GO:0005856(cytoskeleton)|GO:0006936(muscle contraction), ACAAATTACATGGGGAACATAAAGGAGTGAGATCCTTCTGTGATAAAATGAATTCACCAC, ref|NM_024939|ens|ENST00000251366|gb|BC030146|gb|BC052309, Homo sapiens epithelial splicing regulatory protein 2 (ESRP2), mRNA [NM_024939], GO:0000166(nucleotide binding)|GO:0003729(mRNA binding)|GO:0005634(nucleus)|GO:0006397(mRNA processing)|GO:0043484(regulation of RNA splicing), CTCAACTGCTGGCTCTTCTTCCCTTTGTATTTGTGTAAGGAGCACTGCACTCCCATAAAA, ref|NM_004062|ref|NM_001204744|ref|NM_001204745|ref|NM_001204746, Homo sapiens cadherin 16, KSP-cadherin (CDH16), transcript variant 1, mRNA [NM_004062], GO:0005509(calcium ion binding)|GO:0005886(plasma membrane)|GO:0007155(cell adhesion)|GO:0007156(homophilic cell adhesion)|GO:0016021(integral to membrane), GGGAGTGCTCCAAATGTCAGGGTGTTTGCCCAATAATAAAGCCCCAGAGAACTGGGCTGG, ref|NM_006159|ref|NM_001145108|ref|NM_001145107|ref|NM_001145110, Homo sapiens NEL-like 2 (chicken) (NELL2), transcript variant 2, mRNA [NM_006159], GO:0005198(structural molecule activity)|GO:0005509(calcium ion binding)|GO:0005515(protein binding)|GO:0005576(extracellular region)|GO:0007155(cell adhesion)|GO:0040008(regulation of growth), ACATCACCATGTAGAAGAATGGGCGTACAGTATATACCGTGACATCCTGAACCCTGGATA, ref|NM_198390|ref|NM_030629|ens|ENST00000537098|ens|ENST00000539778, Homo sapiens c-Maf inducing protein (CMIP), transcript variant 1, mRNA [NM_198390], GO:0005634(nucleus)|GO:0005737(cytoplasm), CCCCCGCCGAATTCTTTTAGCTTCGTAATTGGAACCTTTGACCTGATCTAAAGTGGACTT.
Taotronics Bluetooth Headphones Not Turning On, Norton Anthology Of World Literature 4th Edition Ebook, Tom Hanson Minnesota, Mt Bachelor Lift Tickets, Live Goldfish Canada, Notion Inline Database,